Introduction
Phytophthora
infestans caused the
famous Great Famine in Ireland in the 19th century, resulting in potato tuber yield loss and approximately
one million people starved to death (Fry and Goodwin 1997a). P. infestans
is known as a heterothallic oomycete. It is widely believed that the firstmigration of P. infestans from
the highlands
of central Mexico likely
occurred in the1840s (Fry and
Goodwin 1997b). Migration plays an important role in the
population structure of P. infestans. Previous studies have suggested that the
population structure of P. infestans changed in the past (Hohl
and Iselin 1984; Fry et al. 1993; Drenth et al.
1994; Wharton et al. 2015). Oosporesmay be expected to beproducedin the
populations of P. infestans
consisting of the A1 and A2
mating types. The
evidence that P. infestans
reproduces sexually on a regular basis is increasing in northern Europe (Yuen
and Andersson 2013). Sexual reproduction may occur, which would contribute toincrease the genotypic diversity in the P. infestans population (Drenth et al.
1994; Pipe et al. 2000; Śliwka et al.
2006). The population characteristics of P. infestans are complex and variable
in many countries and many different virulence races have been identified (Kiiker et al.
2018; Fukue et al. 2018). Potato late blight is considered to be a devastating
disease for potato growers and causes more than $6 billion in losses and
management costs every year (Haverkort et al. 2008). Due to the widespread
use of fungicides, metalaxyl-resistant strains have
been widely reported (Aav et al. 2015).
Mitochondrial (mt)DNA is uniparentally
inherited (Whittaker et al. 1994),
ideal for tracing lines of descent and easily detected. In addition, mtDNA polymorphisms of P.
infestans are used to monitor pathogen populations (Griffith
and Shaw 1998). Haplotype Ib was identified as the ‘old’
population of P. infestans
only in the highlands of central Mexico, andhaplotypes Ia, IIb and IIa
were classified as the ‘new’ population (Runno-Paurson et al. 2009).
Previous studies of phenotypic diversity in China showed
that haplotypes Ia,
IIa and IIb exist in China. Haplotype Ia is the most common genotype
in Fujian (Han et al. 2014), Sichuan
(Li et al. 2013a) and
Yunnan (Zhao et al. 2002) in China,
whereas haplotype IIa is common in Qinghai (Lian et al.
2012).
Although China has become the largest potato
producer in the world (Alva et al.
2011), the further development of the potato industry has been seriously threatened by potato
late blight,
especially in southwestern China. Potato production has
decreased by 30% every year due to this disease. Unfortunately, very little is
known about the population characteristicsof this pathogen in
southwestern China. To better
understand the characteristics of this pathogen in southwestern China,
phenotypic and mtDNA haplotypes were
analysed in this study, and the sampling area covered
the region with the largest potato planting area in China. The results will
provide a guideline for future potato breeding and effective prevention and
control measures for potato late blight.
Materials
and Methods
Collection
and isolations
Potato leaves with single lesions showing
classical typical late blight symptoms were obtained from 33 locations in southwestern China from April to October. The
distance between each sampling point is more than 50 kilometres. The
elevations ranged from 189 m to 3430 m. In those areas, farmers plant
high-quality virus-free seed potato and apply
fungicide three to five times to control potato late blight. The infected leaves were cut into
small pieces (5 mm2) and placed under
potato tuber slices from the susceptible cv. Favorita.
Small tufts of mycelia grew on the potato slices after being
incubated for five to seven days at 18°C in darkness, andthe hyphae
were transferred to culture medium plates with rye B agar and incubated at 18°C (Li et al. 2013a).
During 2012–18, 688 isolates of P. infestans
were collected (Table 1). Some isolates from each site were chosen for
the analysis of the population diversity of P. infestans in terms of mating
type, sensitivity to metalaxyl, virulence race and mtDNA haplotype.
Mating type
detection
Isolates of P.
infestans were evaluated to identify their mating
type on rye B agar by pairing themwith the P. infestans reference
isolates A1 (VK98014) and A2 (90128). The confrontational strains were stored
at 18°C in the
dark for 5 to 7 days and were observed microscopically for oospores in the hyphae interaction
area. Mating types were identified according to the method described by Runno-Paurson et al.
(2009). The isolates generating oospores with the A1 were classified as A2; the
isolates that generating oospores with A2 were classified as A1. The isolates
forming oospores with or without A1 and A2were designated as self-fertile.
Table 1: Origin of P. infestans
isolates collected from southwestern China (2012–2018)
|
Region |
Location |
Number of
isolates |
Latitude |
Longitude |
Altitude
(m) |
|
Guizhou |
Weining |
28 |
26°83' |
104°24' |
2169 |
|
|
Chishui |
8 |
28°47' |
105°76' |
299 |
|
Hubei |
Lichuan |
10 |
30°23' |
108°99' |
1129 |
|
Chongqing |
Kaizhou |
23 |
31°20' |
108°34' |
529 |
|
|
Shizhu |
4 |
29°99' |
108°11' |
553 |
|
|
Wuxi |
20 |
31°41' |
109°56' |
256 |
|
|
Yunyang |
3 |
31°36' |
108°91' |
1280 |
|
|
Zhongxian |
2 |
30°29' |
108°03' |
189 |
|
Sichuan |
Beichuan |
6 |
31°94' |
104°41' |
996 |
|
|
Chaotian |
11 |
32°62' |
106°10' |
1412 |
|
|
Chongzhou |
37 |
30°54' |
103°65' |
508 |
|
|
Danling |
6 |
29°98' |
103°36' |
485 |
|
|
Daofu |
31 |
30°48' |
101°48' |
3430 |
|
|
Ebian |
10 |
29°24' |
103°18' |
1197 |
|
|
Jiangyou |
9 |
31°97' |
104°78' |
588 |
|
|
Leibo |
7 |
28°39' |
103°77' |
1118 |
|
|
Luding |
59 |
29°64' |
102°12' |
1562 |
|
|
Mianning |
9 |
28°74' |
102°25' |
2076 |
|
|
Pengzhou |
193 |
31°21' |
103°78' |
1050 |
|
|
Puge |
1 |
27°48' |
102°48' |
1417 |
|
|
Shunqing |
24 |
31°05' |
106°13' |
324 |
|
|
Tongjiang |
10 |
32°47' |
107°37' |
1200 |
|
|
Wanyuan |
10 |
32°11' |
108°10' |
1044 |
|
|
Xiaojin |
43 |
31°08' |
102°30' |
3162 |
|
|
Xide |
16 |
28°30' |
102°45' |
2410 |
|
|
Xindu |
8 |
30°77' |
104°21' |
478 |
|
|
Xingwen |
8 |
28°27' |
105°29' |
399 |
|
|
Xuanhan |
27 |
31°35' |
107°72' |
297 |
|
|
Yilong |
10 |
30°87' |
106°08' |
313 |
|
|
Zhaojue |
26 |
28°01' |
102°51' |
2600 |
|
Yunnan |
Daguan |
6 |
27°74' |
103°89' |
1135 |
|
|
Huize |
11 |
26°43' |
103°32' |
2129 |
|
|
Ludian |
12 |
27°17' |
103°58' |
1908 |
|
Total |
|
688 |
|
|
|
Metalaxyl resistance assessment
The responses of different isolates to metalaxyl were tested on rye B agar plates (90 mm) with the
corresponding metalaxyl concentration. The fungicide
was dissolved in 0.1% acetone and prepared in a stock of 100 gL-1.
Three different metalaxyl concentrations (0, 5 and 100 mg L-1)
were tested. Uniformly-sized agar plugs (5 mm) were taken from actively
growing colonies of P. infestans, and a plug was placedin the
middle of each plate. After maintaining the cultures for 7 days
at 18°C in the
dark, the diameters of the fungal colonies were evaluated in two perpendicular directions
through the centre of each plate. Three replicates were used
for each isolate. Metalaxyl resistance was determined
according to the following scale: those with growth on both the 5 and 100 mg L-1
plates ≥40% of that on the 0 mg L-1 plate were
regarded as resistant (R), those with growth on the 5 mg L-1 plate
≥40% of that on the 0 mg L-1 plate were regarded as
intermediate (I), and those with growth on both the 5 and 100 mg L-1
plates ≤40% of that on the 0 mg L-1 plate were regarded as
sensitive (S) (Forbes 1997).
Virulence tests
The virulence pathotype was assessed by testing
interactions on a subset of different potato genotypes
with resistance genes R1-R11 (Malcolmson and Black 1966). The
sterile differential potato clones were preserved on Murashige
and Skoog’s medium and were maintained at 23°C with a 16 h light
period. Four fully expanded leaves
were selected from the
potato plants for each isolate andplaced abaxial-side up on a wet
filter paper in aplastic Petri dish. A 10 μL
drop of sporangial suspension (2×104 sporangia mL-1),
prepared after 5–7 days on tuber slices from susceptible cv. Favorita was placed on each leaflet. After inoculation, the
Petri dishes were maintained at 18°C under a16h light period. The leaves
were checked with a stereomicroscope for sporulation 7 days later. If
sporulation was detected, the
interaction was evaluated as compatible; if a
hypersensitive or no symptom response was detected, the interaction was
evaluated as incompatible (Runno-Paurson et al. 2009). The results were credible
when sporulation occurred on the leaves of impressionable potato clone r without any Rgenes.
DNA extraction
Isolates of P.
infestans were incubated at 18°C in the dark for 7 days
individually on potato tuber slices of susceptible cv. Favorita, and mycelia were carefullyharvested
by removing
them with an inoculating needle and
stored at -20°C in
centrifuge tubes for DNA extraction. Genomic DNA from 30 mg of dry mycelium was
purified using anE.Z.N.A.®
Fungal DNA Kit (OMEGA Bio-Tek, USA). The quantity
of the purified
DNA samples was measured using a NanoDrop ND-1000 (NanoDrop Technologies, Inc., USA). The DNA
samples were diluted to 20 ng μL-1
and stored at -20°C for further analysis.
mtDNA haplotypes
The mtDNA haplotypes of the P. infestans isolates
were described
by Griffith and Shaw (1998). The mtDNA regions of
P. infestans were
amplified using primer pair
1 (F2 - TTCCCTTTGTCCTCTACCGAT; R2 - TTACGGCGGTTTAGCACATACA) and primer pair 2
(F4 - TGGTCATCCAGAGGTTTATGTT; R4 - CCGATACCGATACCAGCACCAA). Each PCR (25 μL) mixture consisted of 12.5 μL of 2×Taq
PCR Master Mix (Sangon Biotech Co., Ltd, China), 10 µM of each
primer, 30–50 ng of DNA sample and 8.5 μL of ddH2O. The thermal cycling
procedure was as follows: initial denaturation for 2 min at 94°C, 35 cycles of
denaturation at 94°C for 1 min, annealing at 62°C for 30s and extension at 72°C for 1 min, and a final extension at 72°C for 10 min.
The PCR product P2 was digested with the
restriction enzymes MspI and the product P4 was digested
with the restriction enzymes EcoRI at 37°C for 4 h. Digestion mix P2 (20 μL) consisted of 1 μL of MspI
(10 U µL-1), 2 μL of buffer, 9 μL of ddH2O and 8 μL of the PCR product P2. Digestion mix
P4 (20 μL) consisted of 0.5 μL of EcoRI
(20 U μL-1), 2 μL of buffer, 9.5 μL of ddH2O and 8 μL of the PCR product P4. Thetypes of mtDNA haplotypes were identified according to the sizes of the
digested PCR products (Griffith and Shaw 1998).
Data analysis
The normalised
Shannon index (Sheldon 1969; Runno-Paurson 2009) was used to
summarize the pathotype diversity and the formula was as
follows: Hs = −Σgilngi/lnN, where gi is
the frequency
of races i
and N is the
number of isolates. The index was normalized to a scale of0
(no diversity) to 1 (a unique pathotype per isolate). SPSS version 22.0 (SPSS Inc.,
Chicago, IL, USA) was used for statistical analyses. To identify the
differences in terms of specific virulence among the different
potato R genes or sampling years, ANOVA was performed.
Results
Mating type
In total, 679 isolates were randomly chosen for
each mating type. The results showed that
16.6% of
the isolates were of the A1 mating type, 7.8% of the
isolates were of the A2 mating type and 75.6% of the
isolates were self-fertile (Fig. 1A). Many self-fertile isolates were
detected in the five regions.
A1 mating type isolates were detected
every year, and their frequency
ranged from 26.7 to 4.2% throughout the survey. However, the A2 mating type was not
found in 2015 and 2017, with frequencies ranging from 0 to 33.3%.
Conversely, the self-fertile mating type prevailed among theisolates, and the frequency during
the sampling years was in the range of 60.0–87.7% (Fig.
1B). Interestingly, most isolates collected in the fall in
%201129-1135_files/image002.jpg)
Fig. 1: Frequency
of mating types of P. infestans
isolates from different regions in southwestern China
during the 2012–2018 period. (A) all isolates; (B)
different sampling years; (C) different sampling
regions
%201129-1135_files/image004.jpg)
Fig. 2: Metalaxyl resistance
of P. infestans
isolates from different regions in southwestern China
during the 2012–2018 period. (A) For all isolates; (B) with respect to
mating type; (C) for different sampling years;
(D) for different sampling regions. S: metalaxyl sensitive, I: intermediate metalaxyl
sensitivity, R: metalaxyl resistant
Sichuan in 2016–2018 were of the A1 mating types. The A1, A2 and
self-fertile mating types were sometimesfound in the same field in Sichuan. The
isolates collected from Hubei and Chongqing were allof theself-fertile
mating type. Furthermore, the
self-fertile mating type frequencies in Guizhou and Yunnan provinces were 97.2 and 93.1%, respectively
(Fig. 1C).
Metalaxyl resistance
The metalaxyl resistance
of 299 isolates was determined on rye B agar plates. Of these isolates, 79.6% were
classified as resistant, 17.4% had intermediate sensitivity, and 3.0% were
sensitive to metalaxyl (Fig. 2A). Metalaxyl-resistant isolates were
detected among the three mating types (A1, A2 and
self-fertile mating types), and
no sensitive isolates werefound in the A2 mating type (Fig 2B).
The proportion of metalaxyl-resistant isolates
reached from 55.0 to 91.4% in southwestern
China during the period of 2012–18. The metalaxyl-sensitive phenotype was
not found in 2013, 2014, 2015 or 2017; only 10.0% (n = 2),
4.5% (n = 3)
and 16.0% (n = 4) of the isolates were
sensitive in 2012, 2016 and 2018, respectively (Fig. 2C). All isolates
collected from Guizhou, Hubei and Yunnan were resistant to metalaxyl.
Additionally,
76.6% (n = 183) of the isolates collected from Sichuan
and 80.0% (n=20) of the isolates collected from Chongqing
showed resistance to metalaxyl (Fig. 2D).
Virulence phenotype
%201129-1135_files/image006.jpg)
Fig. 3: Frequency
of virulence to resistance genes in P. infestans
isolates from different regions in southwestern China
during the 2012–2018 period
%201129-1135_files/image008.jpg)
Fig. 4:
Composition and frequency of mitochondrial haplotypes of isolates from
different regions in southwestern China during the
2012–18 period. (A) For all isolates (n=362); (B) for different sampling regions; (C) with respect to
mating type
A total of 365
isolates as representative samples purified from the five provinces were tested for pathogenicity. The results
showed that virulence factors that could overcome all known resistance genes
(R1-R11) were detected. The most common physiological races were 1.2.3.4.5.6.7.8.9.10.11 (26.58%) and
1.2.3.4.5.6.7.8.10.11 (18.90%). The frequency of virulence genes was in the
range of 67–89%; the lowest frequency was found for virulence against R9 (67% ± 4.6 SE) and the highest
frequency was found forvirulence against R6 (89% ± 4.4 SE) (Fig. 3). There were no differences in specific virulence (P≥0.05), but there were significant differences among
the seven years (P≤0.01). Ninety-nine percent of the
tested strains were able to overcome five or more R genes. Moreover, 92
virulence races were detected. The mean number of virulence factors was 9.04 (Table
2) and ranged from 7.2 to 10.4 among the sampling years (Table 3).
The normalized Shannon diversity index of the P. infestans
population in southwest China was 0.55.
mtDNA haplotypes
Three types of mtDNA haplotypes (Ia,
IIa and IIb) were identified in 362 tested isolates.
In total, 78.7% (n = 285) of the isolates were Ia. The frequencies of IIa and IIb were 4.7% (n = 17) and 16.6% (n = 60),
respectively (Fig. 4A). Haplotype Ia
was the common type in all regions, with a frequency of 100% among
the tested isolates from Guizhou and Yunnan and 90.0, 72.0
and 95.0% in Hubei, Sichuan and Chongqing, respectively. Haplotype IIa was detected
in Hubei and Sichuan. Haplotype IIb was found only in Sichuan and
Chongqing (Fig. 4B). Among the five regions, three mtDNA haplotypes were detected in Sichuan. Each mtDNA haplotype contained A1, A2 and self-fertile isolate clones. Most of haplotype
Ia isolates were
self-fertile and most of haplotype IIb isolateswere A1
(Fig. 4C).
Table 2: Number and
frequency of isolates of different races among P. infestans isolates from southwestern China (2012–2018)
|
Race |
Isolates
(n) |
Frequency
(%) |
Race |
Isolates
(n) |
Frequency
(%) |
|
1.2.3.4.5.6.7.8.9.10.11 |
97 |
26.58 |
1.2.3.4.6.7.9.10.11 |
1 |
0.27 |
|
1.2.3.4.5.6.7.8.10.11 |
69 |
18.90 |
1.2.3.4.6.9.10.11 |
1 |
0.27 |
|
1.3.4.6.7.8.10 |
16 |
4.38 |
1.2.3.4.7.8.10 |
1 |
0.27 |
|
1.3.4.5.6.7.8.9.11 |
8 |
2.19 |
1.2.3.5.6.8 |
1 |
0.27 |
|
1.3.4.5.8.9.10 |
8 |
2.19 |
1.2.3.5.6.8.10 |
1 |
0.27 |
|
2.3.5.6.7.8.9.11 |
8 |
2.19 |
1.2.3.6 |
1 |
0.27 |
|
1.2.3.4.5.6.7.8.9.11 |
7 |
1.92 |
1.2.4.5.6.7.8.10 |
1 |
0.27 |
|
1.2.3.4.6.7.8.10 |
7 |
1.92 |
1.2.4.5.6.8.11 |
1 |
0.27 |
|
1.2.4.5.6.8.9.10 |
6 |
1.64 |
1.2.4.5.6.8.9 |
1 |
0.27 |
|
1.3.4.5.6.7.8.9.10.11 |
6 |
1.64 |
1.2.4.5.6.9.11 |
1 |
0.27 |
|
1.2.3.5.6.8.9.11 |
5 |
1.37 |
1.2.4.6.7.9.11 |
1 |
0.27 |
|
1.2.4.6.7.8.9.10.11 |
4 |
1.10 |
1.2.4.7.8.9.10.11 |
1 |
0.27 |
|
1.2.4.6.8.9.10.11 |
4 |
1.10 |
1.2.5.6.7.9.10.11 |
1 |
0.27 |
|
1.2.3.4.5.6.7.9.11 |
3 |
0.82 |
1.3.4.5.6.7.10.11 |
1 |
0.27 |
|
1.2.3.4.5.6.8.9.11 |
3 |
0.82 |
1.3.4.5.6.7.8.10.11 |
1 |
0.27 |
|
1.2.3.4.5.8.9.10.11 |
3 |
0.82 |
1.3.4.5.6.7.8.9.10 |
1 |
0.27 |
|
1.2.3.4.5.8.9.11 |
3 |
0.82 |
1.3.4.5.6.7.9 |
1 |
0.27 |
|
1.2.3.4.6.10.11 |
3 |
0.82 |
1.3.4.5.6.9.10.11 |
1 |
0.27 |
|
1.2.3.4.6.8.10.11 |
3 |
0.82 |
1.3.4.5.7.9.11 |
1 |
0.27 |
|
1.2.4.5.6.7.9.10.11 |
3 |
0.82 |
1.3.4.5.8.10 |
1 |
0.27 |
|
1.2.5.6.7.9 |
3 |
0.82 |
1.3.4.5.8.9.10.11 |
1 |
0.27 |
|
1.2.5.6.7.9.11 |
3 |
0.82 |
1.3.4.5.9.10 |
1 |
0.27 |
|
1.2.5.6.8.9.10.11 |
3 |
0.82 |
1.3.4.6.8.9.10.11 |
1 |
0.27 |
|
1.3.4.5.6.10 |
3 |
0.82 |
1.3.4.7.8.10.11 |
1 |
0.27 |
|
3.4.5.6.7.8.9.10.11 |
3 |
0.82 |
1.3.5.6.7.9.11 |
1 |
0.27 |
|
1.2.3.4.5.6.10.11 |
2 |
0.55 |
1.3.5.6.8.9.11 |
1 |
0.27 |
|
1.2.3.4.5.6.9.10 |
2 |
0.55 |
1.3.5.8.10 |
1 |
0.27 |
|
1.2.3.4.5.9.10 |
2 |
0.55 |
1.3.6.8.10 |
1 |
0.27 |
|
1.2.3.5.6.7.8.9.10.11 |
2 |
0.55 |
1.4.5.6.7.9.10.11 |
1 |
0.27 |
|
1.2.4.5.6.7.8.10.11 |
2 |
0.55 |
1.4.5.6.7.9.11 |
1 |
0.27 |
|
1.2.4.5.6.7.8.9.10 |
2 |
0.55 |
1.4.5.6.8.9.10.11 |
1 |
0.27 |
|
1.2.4.5.6.8.10.11 |
2 |
0.55 |
1.4.5.6.9.10.11 |
1 |
0.27 |
|
1.2.4.6.7.8.10.11 |
2 |
0.55 |
1.4.6.7.8.10.11 |
1 |
0.27 |
|
1.2.5.6.7.9.10 |
2 |
0.55 |
1.4.6.9.10.11 |
1 |
0.27 |
|
1.2.5.6.8.9.10 |
2 |
0.55 |
2.3.4.5.6.8.10 |
1 |
0.27 |
|
1.3.4.5.6.9.11 |
2 |
0.55 |
2.3.4.7.8.9.10.11 |
1 |
0.27 |
|
1.3.4.6.7.8.9.10.11 |
2 |
0.55 |
2.3.4.9.11 |
1 |
0.27 |
|
1.3.4.6.7.9.10 |
2 |
0.55 |
2.3.5.8.9.10 |
1 |
0.27 |
|
1.3.5.8.9.10 |
2 |
0.55 |
2.3.7 |
1 |
0.27 |
|
1.4.5.6.7.8.9.11 |
2 |
0.55 |
2.4.5.6.8 |
1 |
0.27 |
|
2.3.4.5.8.9.10 |
2 |
0.55 |
2.4.5.7.8 |
1 |
0.27 |
|
2.3.5.6.8.9.11 |
2 |
0.55 |
2.4.6.7.9.10.11 |
1 |
0.27 |
|
1.2.3.4.5.6.7.10.11 |
1 |
0.27 |
2.5.6.8.9.10 |
1 |
0.27 |
|
1.2.3.4.5.6.8.10.11 |
1 |
0.27 |
2.6.8.9.10 |
1 |
0.27 |
|
1.2.3.4.5.6.8.9.10.11 |
1 |
0.27 |
3.4.7.8 |
1 |
0.27 |
|
1.2.3.4.6.7.8.9.10.11 |
1 |
0.27 |
5.8.10.11 |
1 |
0.27 |
|
Total
number of isolates |
365 |
|
|
|
|
|
Total
number of races |
92 |
|
|
|
|
|
Virulence
complexity |
9.04 |
|
|
|
|
Discussion
In this
study, A1 and A2 mating types of P. infestans
isolates were found in southwestern China, but most of the isolates were
self-fertile. A2 isolates were only detected in Sichuan and Yunnan, and the
isolates from Hubei and Chongqing were all self-fertile. The A2 mating type has
been subsequently reported in many countries
since the discovery of oospores produced by P.
infestans under natural conditions in Mexico in 1956 (Niederhauser 1956). Since
the first reportofA2 mating type isolates in northern China in 1996
(Zhang et al. 1996), several A2
mating type isolates have been
detected in many regions of China. Previous reports documented that the
frequency of the A2 mating type was 10% in Yunnan, but it was
91% in Sichuan Province (Li et al. 2013b). The self-fertile
isolate was first reported
in China in 2002 (Huang 2002). Many self-fertile
isolates have
been found in China (Li et al. 2009; Li et al. 2013a; Zhu et al. 2015; Tian et al. 2016) and other countries (Aav et al. 2015;
Casa-Coila et
al. 2017). The probability of theoccurrence of self-fertile
isolates isrelated to the
survival, environment and genetic
structure of P. infestans,
and there are
many cultural practices in which the age of the culture, presence of other
organisms, wounding and the addition of fungicide to
the culture medium can override heterothallism-inducing oospore production in P. infestans
(Smart et al. 2000). Self-fertile
isolates that replaced A1 and A2 mating type isolates
were the dominant clones in
southwestern China, indicating that sexual reproduction can occur in all
studied potato fields. Early epidemics of potato late blight can be caused by
oospores in the field (Hannukkala et al. 2007; Brylińska
et al. 2016). In contrast to
sporangia, oospores can withstand adverse
conditions or circumstances and survive into the next growing season in the
soil without a host (Andersson et al. 1998; Fernández-Pavía et al. 2004; Lehtinen
and Hannukkala 2004). Furthermore, sexual
reproduction not only increases the genotypic variability in P. infestans
populations, but may also cause
increased pathogenicity and/or antimicrobial resistance (Fry et al. 1993; Harutyunyan
et al. 2008; Lozoya-Saldaña 2011).
Fungicide-resistance
testing indicated that metalaxyl-resistant isolates arewidespread
in southwestern China. The occurrence of metalaxyl-resistant isolates was not
associated with the mating types. Many resistant
isolates were detected in Yunnan (Zhao et
al. 2007) in China. Resistance to metalaxyl was found in three regions, Guizhou,
Hubei and Yunnan, with the highest proportion among the
self-fertile isolates in our study. Metalaxyl-based fungicides are recommended for usein many
regions because of their
low price and high
quality. It is possible that extensive use of fungicides caused the increase in
the metalaxyl-resistant population. These studies
suggest that it is necessary to change the strategy of using metalaxyl to control potato late blight. With the
application of potato-resistant
varieties and crop rotation (Bimšteine 2008), the
amount of fungicides used can be reduced.
Table 3: Frequency
of virulence to potato R genes among isolates across seven sampling years in southwestern China
|
Resistance gene |
Sampling years |
||||||
|
2012 |
2013 |
2014 |
2015 |
2016 |
2017 |
2018 |
|
|
R1 |
87 |
62 |
87 |
81 |
100 |
100 |
100 |
|
R2 |
93 |
55 |
57 |
55 |
88 |
91 |
100 |
|
R3 |
87 |
86 |
68 |
81 |
82 |
92 |
93 |
|
R4 |
53 |
62 |
70 |
84 |
100 |
99 |
100 |
|
R5 |
87 |
72 |
70 |
58 |
89 |
92 |
93 |
|
R6 |
100 |
72 |
86 |
77 |
88 |
100 |
100 |
|
R7 |
67 |
52 |
59 |
68 |
73 |
93 |
93 |
|
R8 |
100 |
86 |
63 |
74 |
89 |
96 |
100 |
|
R9 |
93 |
69 |
62 |
55 |
66 |
63 |
64 |
|
R10 |
60 |
62 |
79 |
71 |
78 |
92 |
100 |
|
R11 |
93 |
45 |
48 |
61 |
87 |
96 |
100 |
|
Mean
number of virulence isolates |
9.2 |
7.2 |
7.5 |
7.6 |
9.4 |
10.2 |
10.4 |
|
Number of
isolates tested |
15 |
29 |
63 |
31 |
94 |
119 |
14 |
In our study, 92
different pathogenic types were identified among365 isolates and the
virulence complexity was 9.04. The most common race was
1.2.3.4.5.6.7.8.9.10.11, which was virulent to 11 known R genes. This means that
the P. infestans
population in southwestern China is highly diverse and complex. The proportion of virulence
against R genes was also different in other countries (Chmielarz et al. 2014), and the sexual reproduction in the P. infestans
populations has been
detected in some countries (Kiiker et al. 2018). Planting resistant
cultivars is an economical way to control
potato late blight, but susceptible cultivars, such as cv. Favorita, are widely grown due to the short growth period,
such as cv. Favorita. In some poor areas in
southwestern China, cheap fungicides, such as metalaxyl-based
fungicides, areapplied for potato
late blight control, or nothing is done about
such infestations. As a
result, potato late blight is common in southwestern China. There is a high
level of pathotype diversity in southern China. This finding might be
related to the specific
conditions of year-round potato cultivation.
Overall, mtDNA haplotype tests
revealed that all isolates in southwestern China were the ‘new’ population of P. infestans.
The most common mtDNA haplotype
was Ia,
followed by haplotypes IIb and IIa; Ib is not detected in this
study. Many researchers
have reported that haplotype Ia is dominant
in most of the populations of P. infestans
studied (Shimelash et al. 2016; Fry et al.
1993). The proportion of each mtDNA haplotype differed in thedifferent
regions in China. Haplotype IIa dominated the
population of P. infestans
in north-eastern China, growing
faster than the other two haplotypes (IIa and IIb) on
rye B agar medium (Tian et al. 2018).
Conclusion
The
population of P. infestans
in southern China is diverse and complex. Seventy-six percent
of the tested isolates were self-fertile, 80% of the tested isolates were metalaxyl-resistant, and 26.58% of the tested isolates were
members of the
most common physiological race1.2.3.4.5.6.7.8.9.10.11. This suggests
that metalaxyl-based fungicides should be carefully
used and that
resistance to metalaxyl should be monitored in southern China. The
control strategies for potato late blight should be organically combined with
the different cultivation models, which contribute to maintaining biodiversity
and suppressing
the occurrence of late
blight.
Acknowledgements
This work was funded by the
Sichuan Science and Technology Program (2016NYZ0053), which was also supported
by the Institute of Plant Protection, Sichuan Academy of Agricultural Sciences.
References
Aav A, I Skrabule, G Bimšteine,
T Kaart, IH Williams, E Runno-Paurson
(2015). The structure of mating type, metalaxyl
resistance and virulence of Phytophthora infestans isolates collected from Latvia. Zemdirbyste-agriculture 102:335‒342
Alva A, MS Fan, C Qing, C Rosen, HQ
Ren (2011). Improving nutrient-use
efficiency in Chinese potato production: Experiences from the United
States. J Crop Improv 25:46‒85
Andersson B, M Sandström,
A Strömberg (1998). Indications of soil-borne inoculum of Phytophthora infestans. Potato
Res 41:305‒310
Bimšteine G (2008). Phytophthora infestans
populations in Latvia. Proc.
Latvian Acad Sci 62:223‒226
Brylińska M, S Sobkowiak,
E Stefańczyk, J Śliwka
(2016). Potato cultivation system affects population structure of Phytophthora infestans. Fungal Ecol 20:132‒143
Casa-Coila VH, MS Lehner, BTH Júnior, A Reis, NRX Nazareno,
ESG Mizubuti, CB Gomes (2017). First report of Phytophthora infestans
self-fertile genotypes in southern brazil. Plant Dis 101:1682
Chmielarz M, S Sobkowiak,
K Dębski, DEL Cooke, MB Brurberg,
J Śliwka (2014). Diversity of Phytophthora infestans from Poland. Plant Pathol 63:203‒211
Drenth A, ICQ Tas, F Govers
(1994). DNA fingerprinting uncovers a new sexually reproducing population of Phytophthora infestans
in the Netherlands. Eur J Plant Pathol 100:97‒107
Fernández-Pavía SP, NJ Grünwald, M Díaz-Valasis,
M Cadena-Hinojosa, WE Fry (2004). Soil-borne oospores of Phytophthora infestans in central Mexico
survive winter fallow and infect potato plants in the field. Plant Dis 88:29‒33
Forbes GA (1997). Manual
for laboratory work on Phytophthora infestans. Centro Internacional
de la Papa, Quito, Ecuador
Fry WE, SB Goodwin (1997a). Re-emergence
of potato and tomato late blight in the United States. Plant Dis 81:1349‒1357
Fry WE, SB Goodwin (1997b). Resurgence
of the Irish potato famine fungus. Bioscience
47:363‒371
Fry WE, SB Goodwin, AT Dyer, JM Matuszak, A Drenth, PW Tooley, LS
Sujkowski, YJ Koh, BA Cohen, LJ Spielman, KL Deahl, DA Inglis, KP Sandlan (1993).
Historical and recent migrations of Phytophthora infestans: Chronology, pathways and implications. Plant Dis 77:653‒661
Fukue Y, S Akino, H Osawa,
N Kondo (2018). Races of Phytophthora infestans isolated from potato in Hokkaido,
Japan. J Gen Plant Pathol 84:276‒278
Griffith GW, DS Shaw (1998). Polymorphisms in Phytophthora infestans: Four mitochondrial haplotypes are detected
after PCR amplication of DNA from pure cultures or
from host lesions. Appl Environ Microb 64:4007‒4014
Han LL, C Yang, X Pan, JS Zhan, W Zhu (2014). Identity
of the mtDNA haplotype(s) of Phytophthora infestans in Fujian
province. Acta Laser Biol Sin 23:165‒169
Hannukkala AO, T Kaukoranta, A Lehtinen, A Rahkonen (2007).
Late-blight epidemics on potato in Finland, 1933–2002; increased and earlier
occurrence of epidemics associated with climate change and lack of rotation. Plant Pathol
56:167‒176
Harutyunyan SR, ZJ Zhao, TD
Hartog, K Bouwmeester, AJ Minnaard, BL Feringa, F Govers (2008). Biologically active Phytophthora
mating hormone prepared by catalytic asymmetric total synthesis. Proc Natl Acad
Sci USA 105:8507‒8512
Haverkort AJ, PM Boonekamp, R Hutten, E
Jacobsen, LAP Lotz, GJT Kessel, RGF Visser, EAG van
der Vossen (2008). Societal costs of late blight in
potato and prospects of durable resistance through cisgenic
modification. Potato Res 51:47‒57
Hohl HR, K Iselin (1984). Strains of Phytophthora infestansfrom
Switzerland with A2 mating type behaviour. Trans Br Mycol Soc 83:529‒530
Huang H (2002). Homothallic Phytophthora
infestans was found in China. Acta Phytopath Sin 32:347‒350
Kiiker R, M Hansen, IH Williams, DEL
Cooke, E Runno-Paurson (2018). Outcome of sexual reproduction in the Phytophthora infestans
population in Estonian potato fields. Eur J Plant Pathol 152:395‒407
Lehtinen A, A Hannukkala (2004). Oospores
of Phytophthora infestans in soil provide an
important new source of primary inoculum in Finland. Agric Food Sci 13:399‒410
Li BJ, QH Chen, X Lv, CZ Lan, J Zhao, RZ Qiu, QY Weng (2009). Phenotypic and genotypic characterization of Phytophthora infestans isolates from
china. J Phytopathol 157:558‒567
Li HH, HX Peng,
YD Xi, XL Wang, BW Liu (2013a). Characteristics of mating types, physiological races, metalaxyl sensitivity and mtDNA
haplotypes of Phytophthora infestans in Sichuan Province. Sci Agric Sin 46:728‒736
Li Y, T Lee, JH Zhu, GH Jin, CZ Lan, SX Zhu, RF Zhang, BW Liu, ZJ Zhao,
G Kessel, SW Huang, E Jacobsen (2013b). Population structure of Phytophthora infestans in china – geographic clusters and
presence of the EU
genotype Blue_13.
Plant Pathol
62:932‒942
Lian YH, GJ Ye, J Wang (2012). Identification and analysis of mitochondrial
haplotypes on potato Phytophthora infestans in Qinghai area. Acta Phytopath Sin 42:164‒168
Lozoya-Saldaña H (2011). Evolution of vertical and horizontal
resistance and its application in breeding resistance to potato late blight.
Potato J 38:1‒8
Malcolmson JF, W Black (1966). New R genes in Solanum demissum
Lindl. A and their
complementary races of Phytophora infestans
(Mont.) de Bary. Euphytica 15:199‒203
Niederhauser JS (1956). Division of mycology: The blight, the blighter and the
blighted. Trans NY Acad Sci 19:55‒63
Pipe ND, V Azcoitia, DS Shaw (2000). Self-fertility in Phytophthora infestans: Heterokaryons segregate several phenotypes. Mycol Res 104:676‒680
Runno-Paurson E, WE Fry, KL Myers, M Koppel, M Mänd
(2009). Characterisation of Phytophthora infestans isolates collected
from potato in Estonia during 2002–2003. Eur J Plant Pathol
124:565‒575
Sheldon AL (1969).
Equitability indices: Dependence on the species count. Ecology 50:466‒467
Shimelash D, T Hussien, C Fininsa,
G Forbes, J Yuen (2016). Mitochondrial DNA assessment of Phytophthora infestans isolates from
potato and tomato in Ethiopia reveals unexpected diversity. Curr Genet 62:657‒667
Śliwka J, S Sobkowiak,
R Lebecka, J Avendaño-Córcoles,
E Zimnoch-Guzowska (2006). Mating type, virulence, aggressiveness and metalaxyl resistance of isolates of Phytophthora infestans in Poland. Potato Res 49:155‒166
Smart CD, H Mayton, ESG Mizubuti,
MR Willmann, WE Fry (2000). Environmental
and genetic factors influencing self-fertility in Phytophthora infestans. Phytopathology 90:987‒994
Tian HY, JZ Jiang, CB Li, N Hou, F Shen, Y Li (2018). Identity
of the mtDNA haplotype and biological characteristics
of Phytophthora infestans
in Northeast China. J Agric Univ Hebei 41:25‒31
Tian YE, JL Yin, JP Sun, YF Ma, QH Wang, JL Quan, WX Shan (2016). Population genetic analysis of Phytophthora
infestans in northwestern
China. Plant Pathol 65:17‒25
Wharton PS, P Nolte, WW Kirk, S Dangi, A Gevens (2015).
First Report of Late Blight Caused by Phytophthora
infestans Clonal Lineage US-23 on Potato in
Idaho. Plant Dis 99:417‒417
Whittaker SL, SJ Assinder, DS Shaw (1994). Inheritance of mitochondrial DNA in Phytophthora infestans. Mycol Res 98:569‒575
Yuen JE, B Andersson (2013). What is the evidence for sexual
reproduction of Phytophthora infestans in Europe?
Plant Pathol 62:485‒491
Zhang ZM, YQ Li, SM Tian, JH Zhu, J Wang, BF Song (1996). The occurrence
of potato late blight pathogen (Phytophthora infestans)A2 mating type in China. J Agric Univ Hebei 19:62‒65
Zhao ZJ, JF Cao, CH Li, DW Sun, MY Yang, J Wang (2007). Characteristics of mating type, metalaxyl
sensitivity, mtDNA haplotype and succession of Phytophthora infestans
populations in Yunnan, 2000 to 2003. Sci
Agric Sin 40:727‒734
Zhao ZJ, XP Li, CY Li (2002). Molecular determination
on mitochondrial DNA haplotypes of Phytophthora
infestans in Yunnan of China. J Yunnan Agric Univ 17:17‒20
Zhu W, LN Yang, EJ Wu, CF Qin, LP Shang, ZH Wang, JS
Zhan (2015). Limited sexual reproduction and quick turnover
in the population genetic structure of Phytophthora
infestans in Fujian, China. Sci Rep 5; Article 10094